Btbd35f23

Author: prma

August undefined, 2024

WebStandard name: MIR_6957_3P: Systematic name: MM2175: Brief description: Genes predicted to be targets of miRBase v22 microRNA mmu_miR_6957_3p in miRDB v6.0 with MirTarget v4 prediction scores > 80 (high confidence targets). WebGSEA Home; Downloads; Molecular Signatures Database; Documentation; Contact; Team

Sequence Detail

WebPCR primers for off-targets of TGCAAGTGACTGCAGGGATA TGG. In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. WebBtbd35f23 Mouse Gene Details BTB domain containing 35, family member 23 International Mouse Phenotyping Consortium. Phenotype data for mouse gene … horncastle bus station

Gm21950 Kits Biocompare

WebEffector differentiation downstream of lineage commitment in ILC1 is driven by Hobit across tissues Friedrich et al., Nature Immunology (DOI: 10.1038/s41590-021-0101-0) WebMouse Btbd35f23 (NM_001270667) cDNA/ORF clone Catalog Number: 717852-1 1 / 2 General Information Gene Name: BTB domain containing 35, family member 23 Official … WebBtbd35f23 BTB domain containing 35, family member 23 [ (house mouse)] Gene ID: 100861966, updated on 25-Jan-2024 Summary Other designations mouse germ cell-less … horncastle cake art horncastle

Mouse Gene Set: MIR_7007_5P - gsea-msigdb.org

Btbd35f23

Webccl7 :PCR primers for off-targets of GGAGAGACATTAAACTAGGG TGG In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience.

Did you know?

WebMar 30, 2024 · The Frigidaire FGSC2335TF is a mid-range side-by-side refrigerator, which will sit flush with the rest of your countertop appliances, making it a great choice if you … WebView detailed information about property Tbd 23 Acres County Road 3335, Cookville, TX 75558 including listing details, property photos, school and neighborhood data, and …

WebStandard name: NAA10_TARGET_GENES: Systematic name: MM1847: Brief description: Genes containing one or more binding sites for UniProt:Q9QY36 (Naa10) in their promoter regions (TSS -1000,+100 bp) as identified by GTRD version 20.06 ChIP-seq harmonization. WebBtbd35f23 Name BTB domain containing 35, family member 23 Synonyms Gm21950 Feature Type protein coding gene IDs MGI:5439401 NCBI Gene: 100861966 Alliance …

WebFor MOUSE66824 OMA predicts the following 103 pairwise orthologs WebHOMER motif enrichment analysis PHF6 ChIPseq annotated genes Consensus q-value (Benjamini) CCCCGCGC DHNDWATCGATD CKGAWWTTCHGS NYWACTTTTT DTHACTTTTT WHWHHACTTTTT

WebBtbd35f23 CRISPRa kit - CRISPR gene activation of mouse BTB domain containing 35, family member 23 Mouse Btbd35f23 activation kit by CRISPRa, GA219673 AMSBIO …

WebOfficial Symbol Btbd35f23 Official Full Name BTB domain containing 35, family member 23 Also Known As Btbd35f1,Gm21950,Gmcl1l,Gmcl1p1,Gmcl2,Mgclh horncastle canal restorationWebGm21950 (untagged) - Mouse predicted gene, 21950 (Gm21950) The store will not work correctly in the case when cookies are disabled. horncastle campusWeb1000: 750: 500: 250: 1: 0 (Values = Binding scores of MACS2 and STRING) horncastle butchersWebRADAR Search for sensor designs Human genes Mouse genes Code. Mus musculus genes A1BG (Ensembl: ENSMUSG00000022347) A1CF (Ensembl: ENSMUSG00000052595) A26C2 (Ensembl: ENSM horncastle canalWebINVOLVED IN germ cell development (inferred) {{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}}) horncastle car repair sWebStandard name: MIR_466N_3P: Systematic name: MM2873: Brief description: Genes predicted to be targets of miRBase v22 microRNA mmu_miR_466n_3p in miRDB v6.0 with MirTarget v4 predi horncastle cafeWebMouse Btbd35f23 activation kit by CRISPRa. Detection Target: Btbd35f23; Applications: CRISPR, Gene Expression; Quantity: 1 kit; Supplier Page Sign In or Register to view … horncastle car boot sales